Research Article

Identification of Predominant Lactic Acid Bacteria Associated with Kunun-Zaki and Kindirmo a Traditional Fermented Food of Nigeria

Timothy Bamgbose1,2,4,*https://orcid.org/0000-0002-7589-0621, Swati Sinha1, Isa O. Abdullahi2, Helen I. Inabo2, Mohammed Bello3, Lokesh D. Kori1, Elmer N. Ametefe5, Anupkumar R. Anvikar1
Author Information & Copyright ▼
1India Council of Medical Research, National Institute of Malaria Research (ICMR-NIMR), Dwarka-Sector 8, New Delhi, India
2Department of Microbiology, Ahmadu Bello University, Samaru Zaria, Kaduna, Nigeria
3Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University, Samaru Zaria, Kaduna, Nigeria
4West Africa Centre for Cell Biology of Infectious Pathogens (WACCBIP), University of Ghana, Legon-Accra
5Department of Biochemistry Cell and Molecular Biology, University of Ghana, Legon-Accra
*Corresponding author : Timothy Bamgbose, India Council of Medical Research, National Institute of Malaria Research [ICMR-NIMR], Sector 8, Dwarka, New Delhi, India 110077. Tel: +2348057334637, E-mail: princeteejay25@yahoo.in

Copyright © Korean Society for Lactic Acid Bacteria and Probiotics. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: May 25, 2022; Revised: Jun 22, 2022; Accepted: Jun 23, 2022

Published Online: Jun 30, 2022

Abstract

Human intestinal flora is very diverse; with lactic acid bacteria (LAB) existing as part of the most vital gut microbes that improve host health. The application of LAB as a whole organism or its metabolite in the case of probiotic and bacteriocin respectively is extensive. Thus, the need to always bio-prospect for newer strains of LAB is essential. This study focused on isolating LAB from kunun-zaki and kindirmo, a fermented non-alcoholic beverage of non-dairy and dairy sources respectively, explored their physiological and biochemical properties, antibiotics sensitivity pattern and identified based on their 16S rRNA sequencing. A total of eighty isolates were selected sixty-six from kunun-zaki and fourteen from kindirmo in which 93.7% were bacilli and 6.3% were spherical in shape having 68.75% and 30% homofermentative and heterofermentative pathway respectively. All isolates have the ability to utilize glucose to produce lactic acid while their tolerance to pH 3 and salt concentration at 2%, 4% and 6.5% varied widely. Thirty-four isolates based on their physiological and biochemical properties were selected for molecular identification to ascertain their genera and species. Limosilactobacillus fermentum (68%); Lactiplantibacillus plantarum (6%) and Weissella confusa (3%) were confirmed species isolated. Thus, it was concluded that traditional fermented foods such as kunun-zaki and kindirmo are a good source to bio-prospect for LAB for product development, starter culture and probiotic study.

Keywords: fermented food; gut health; Kunun-zaki; Kindirmo; Limosilactobacillus

INTRODUCTION

Lactic acid bacteria (LAB) have been recognized as part of the main fermentative agent in food fermentation with the Lactobacillus general being the most important in food processing within the group (Olasupo et al., 1997; Pasolli et al., 2020). For functional food development, LAB include the best microorganism used and they are abundant in nature especially in fermented food all over the world (Tamang and Samuel, 2010; Franz et al., 2014). Some traditional nourishments in Africa that contain LAB naturally are highlighted by Olasupo et al. (1997) and Franz et al. (2014) includes “Ogi”, “Fufu”, “Kunnu”, “Iru”, “Lafun”, “Ogiri”, “Nunu”, “Kindirmo” and “Wara” amidst many others. Most of these traditional foods are being consumed for ages, still needs optimization before they can be suitable to serve as a delivery vehicle for probiotics. However, as the important first step is to investigate the diversity of LAB found and associated with traditional food, this study has focused on kunun-zaki and kindirmo. Kunun-zaki is a cereal fermented drink (Gaffa et al., 2002) and the production involves soaking the millet for a period of time, grinding followed by sedimentation and afterwards a quarter is permitted to ferment at ambient temperature while the remaining is boiled before mixing the two parts together (Oyewole, 1997, Oguntoyinbo et al., 2012). At the time of production, naturally occurring LAB ferments the cereal which gave kunun-zaki its characteristic flavour and taste (Oguntoyinbo et al., 2012). While, Kindirmo a regular fermented milk amidst the Fulani herdsmen in Nigeria, despite of their nomadic nature it has been introduced to the mainstream populace (Sudi et al., 2011). It is produced by boiling raw milk and letting it to ferment naturally overnight. Often, a good portion of the former produce is kept for the inoculation of a new one serving as starter culture. The organoleptic property might vary from vendor to vendor due to difference in the type of starter culture used (Igwe et al., 2014), contaminant or change in seasonal temperature that might affect the rate of fermentation (Abdullahi et al., 2001).

These two traditional beverages are non-carbonated and non-alcoholic drink (Gaffa, 2002) from non-dairy and dairy sources widely accepted and consumed in various part of Nigeria irrespective of social class (Fapohunda and Adeware, 2012, Jaiyeoba et al., 2019). Although, Kunun-zaki (fermented millet—a non-dairy drink) is readily available and progressively being found across all states in Nigeria (Franz et al., 2014) whereas, Kindirmo (a dairy fermented drink) (Igwe et al., 2014) is consumed predominantly in the North (Abdullahi et al., 2001). Both are a product of chanced fermentation that involves diverse community of microorganism playing different roles in the process of fermentation (Gaffa and Gaffa, 2004).

Fermented foods traditionally produced have been consumed for many centuries across diverse culture depending on the cuisine of the geographical location (Heinen et al., 2020). The various fermented food from Africa have also been well documented and the continent is known to have diverse fermented food products (Oyewole, 1997; Holzapfel, 2002; Anukam and Reid, 2009, Tamang and Samuel, 2010). As a result of the active metabolic compound released by LAB that affects the sensory properties of food and their antimicrobial potential they are more desirous in the fermentation process as they elongate product’s shell life (Bamgbose, 2014; Dimidi et al., 2019; Heinen et al., 2020).

MATERIALS AND METHODS

Collection of Samples

Eighteen samples of kunun-zaki and thirteen samples of kindirmo were bought from local sellers from different outlets in Nigeria. They were kept in a sterile bottle and taken to the laboratory in ice pack for analysis. The samples were immediately prepared for isolation while the remaining were stored at 4°C and analysed within 48 h (Oguntoyinbo et al., 2012).

Isolation of Lactic Acid Bacteria

Samples were serially diluted using maximum recovery diluent (MRD) (Reuben et al., 2019). One millilitre aliquots of the samples were transferred into 9 ml MRD and serially diluted up to 10-9 dilutions. Each dilution was plated on selective medium for LAB de Man, Rogosa Sharpe (MRS) agar (Hi-Media, pH 6.4) (De Man et al., 1960) and incubated anaerobically at 37°C for 48 h following the procedure of Hawaz (2014). After incubation, single distinct colonies were chosen and further purified by streak plate technique and the individual colonies after incubation were inoculated into sterile MRS broth (Hi-Media, pH 6.5) (Bassyouni et al., 2012, Ida et al., 2017). All media used were prepared fresh every day and autoclaved at 121°C for 15 min.

Characterization of Bacterial Isolates

The distinct colonies were subjected to Gram’s reaction and catalase test for presumptive selection of LAB (Hawaz 2014). The gram positive and catalase negative isolates were further characterized based on physiological and biochemical tests (Briugs, 1953; Bayili et al., 2019). Following the procedure of Kavitha and Devasena (2013), a thin smear was made on glass slide using colony of an overnight culture. The smear was then air dried, heat fixed and stained with crystal violet for 60 s and rinsed with water. Subsequently, Lugol’s iodine (mordant) was used to fix the primary stain and rinsed with water. Later, the slide was decolourised by acetone and rinsed with water. Safranin was used as counter stain and left for 30 s, which was afterward washed with distil water. The stained smear was air dried and observed under the light microscope (Olympus oic) using ×100 oil immersion objective. Further, 3% hydrogen peroxide was added to 1 mL of 18 h old cultures. The isolates, that did not produce gas bubbles, were selected as being catalase negative (Bayili et al., 2019).

Long Term Storage and Revival of Isolates

Isolates that were identified as Gram positive and catalase negative were stored in MRS broth medium containing 20% (v/v) glycerol as frozen stocks at -20°C and -80°C. The glycerol stocks of samples were prepared by inoculating a loop full of overnight culture in a mixture of 1.2 mL MRS broth and 0.3 mL of 80% sterile glycerol in 2 mL cryovials following the procedure of Ida et al. (2017). To revive the isolate, a loop full of isolate from cryovial was streaked on the agar and incubated under anaerobic condition for 24 h – 48 h. Individual colony was picked and inoculated into another MRS broth medium and stored in -80°C freezer while other colony was used for further study.

Physiological and Biochemical Characterization of the Isolated Lactic Acid Bacteria

The propagation of LAB isolates were studied in MRS broth at temperature 15°C and 45°C (Harrigan, 1998; El Soda et al., 2003) while growth at different sodium chloride (NaCl) concentrations and CO2 production from glucose (Hawaz, 2014) were carried out.

Growth at different temperature

To test for the ability of isolates to grow at different temperature, MRS broth containing Bromothymol blue indicator was used as the test media and 5 mL of the medium transferred into test tubes. Afterwards, 50 μL of overnight culture was inoculated into the tubes and incubated for 10 days at 15°C and 7 days at 45°C (El Soda et al., 2003). During the incubation time, cell growth at each temperature was determined by the change of colour in the culture medium, from blue to yellow.

Tolerance of lower pH

In order to see the ability of the isolate to tolerate lower pH, MRS broth was adjusted to pH 3.0 and overnight culture was inoculated into it and incubated at 37°C for 24 h (Bassyouni et al., 2012). 200 μL of suspended cell serves as positive control, 200 μL of broth with no suspended cell was used for monitoring contamination while 200 μL of MRS broth (pH 3) with no suspended cells served as negative control. Optical density was taken before and after incubation at OD = 600 nm to determine the LAB growth.

Growth at different NaCl concentration

For further physiological differentiation, isolates were evaluated for their tolerance against different sodium chloride (NaCl) concentrations (2%, 4% and 6.5% w/v) (Shehata et al., 2016). Using a 96 well microtiter plate, 150 μL of NaCl medium were inoculated with 50 μL of overnight suspended cell cultures and then incubated at 37°C for 24 h (Kavitha and Devasena, 2013). 200 μL of suspended cell serves as positive control, 200 μL of broth with no suspended cell was used for monitoring contamination while 150 μL of medium plus 50 μL of broth with no suspended cells served as negative control 1 and 200 μL of NaCl medium served as negative control 2. Optical density was taken before and after incubation at OD = 600nm to determine the LAB growth.

Carbohydrate fermentation test

To study the carbohydrate fermentation and other biochemical profile of each isolates, HiCarbohydrateTM kit (Cat# KB009, HiMedia) was used. Overnight culture of the isolate was centrifuged at 5,000 rpm for 10 min to harvest the cells; the cells were re-suspended in PBS (pH 7.4) and centrifuged at 5,000 rpm to wash it. Subsequently, 50 μL of the cells were adjusted to OD 0.5 at 600nm and inoculated on to the surface of the HiCarboTM wells using a sterile pipette. The strips were then incubated at 37°C for 24 h and the change in colour was observed and noted as positive reaction (+) or negative reaction (-) according to the colour change. A change from pinkish red to yellow indicates positive reactions for the carbohydrate as indicated in the manufacturer’s manual.

CO2 production from glucose

To know the fermentative pathway of each isolate, whether they are homofermentative or heterofermentative, CO2 production from glucose were tested for by using citrate lacking MRS broths using inverted Durham tubes in 1% overnight fresh cultures at 37°C for 24 h by following the method of Kavitha and Devasena (2013). Presence of gas raise up the Durham tubes is an evidence of CO2 production from glucose and thus a hetero-fermentative pathway (Briugs, 1953).

Antibiotic Resistant Pattern of the Isolated Lactic Acid Bacteria

One millilitre (108cfu/mL) of actively grown culture of the isolates was pipetted into petri plates, followed by pouring 10 mL of MRS agar into it. The mixture was gently swirled, allowed to stand till it solidifies. With the aide of sterilized forceps, antibiotic discs (HiMedia, Mumbai) - erythromycin (10g), gentamycin (50g), vancomycin (10g) were aseptically positioned on the surface of the already solidified agar and kept in biosafety cabinet for 30 min for the antibiotics to diffuse. Afterwards, the petri plates were further incubated anaerobically at 37°C for 24 h according to the method of Ida et al. (2017). Based on clusters of different physiological and biochemical properties, thirty-four (34) isolates were selected for 16S rRNA molecular analysis.

Molecular Identification of the Isolated Lactic Acid Bacteria
Extraction of bacterial nucleic acid

The pure colony isolated was grown in 5 mL MRS broth at 37°C for 24 h in an anaerobic condition and was used for the extraction of the genomic DNA (gDNA) of the LAB. Further, broth culture was centrifuged (8,000 rpm, 10 min, 4°C) to harvest the cell. The harvested cells were washed in 1X PBS (pH 7.2) by centrifuging the cells at 8,000 rpm. The supernatant was removed and step repeated twice. Pellets were used for the DNA extraction by re-suspending it into 200 μL of 1X PBS. The DNA extraction were carried out using QIAampR DNA isolation kit (Qiagen, Germany, Lot:160052636) as per manufacture’s instruction. The DNA was eluted in 150 μL of elution buffer (provided with the kit) and the weight measured using NanoDrop spectrophotometer.

DNA amplification

Extracted DNA was subjected to PCR using universal 27F and 1429R primers and specific primers for L. fermentum (Table 1) to amplify the 16s rRNA in the bacterial genome. The PCR reaction mixture consists of 12.5 μL of GoTaq® DNA polymerase (Promega; #cat.no. M7123); 1 μL (0.5 μM) of forward and reverse primer (GCC Biotech); 8.5 μL of nuclease free water and 2 μL of DNA template to make a final volume of 25 μL. The thermal cycler program was set as initial denaturation 95°C for 3 min, denaturation 94°C for 30 s, Annealing 52°C for 45 s, Extension 72°C for 1 min and final extension at 72°C for 10 min for 35 cycles carried out in Applied Biosystem (ABS).

Table 1. List of primers used in this study
S/N Primer Sequence (5’→ 3’)
1 27F AGAGTTTGATCCTGGCTCAG
1429R GGTTACCTTGTTACGACTT
2 Fermenticum-F GACCAGCGCACCAAGTGATA
Fermenticum-R AGCCTAGCGTTCGTGGTAAT
Download Excel Table
Gel electrophoresis

The amplified PCR products were separated on 1% (w/v) agarose gel electrophoresis (Genetix Biotech Asia Pvt. Ltd.); band pattern was visualized by ethidium bromide (EtBr 0.5 mg/mL) and photographed in gel documentation system (Uvitech Cambridge).

Sanger sequencing

All the amplified products were subjected to Sanger sequencing (Eurofins Genomics, Bengaluru, India) and the obtained nucleotide sequences were Nucleotide-BLAST in NCBI database. Similarity ≥ 97% with existing gene in NCBI database were used for confirmation of identity.

Phylogenetic tree construction

The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 0.57724294 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) were shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method and were in the units of the number of base differences per site. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA6.

Statistical analysis

All data were managed and computed using Microsoft Excel 2010 while descriptive analysis at 95% confidence interval and one-way analysis of variance (ANOVA) at p < 0.05 significance level were carried out using Statistical Product and Service Solutions (SPSS v 16).

RESULTS

Characterization of the Lactic Acid Bacteria

The population of isolated bacteria ranges from 105 – 107 for kunun-zaki and 108 - 109 for kindirmo. From the thirty one samples, eighty (80) isolates [66 kunun-zaki, 14 kindirmo] were presumptively selected as LAB based on their grams reaction, catalase test (Harrigan, 1998) and morphology (Fig. 1) (Sharpe, 1979). They were all Grams’ positive (Fig. 2) and catalase negative with varying morphology - bacilli (93.7%) and spherical (6.3%).

labp-8-1-17-g1
Fig. 1. Purification by streak culture. Streak culture to obtain a single colony, in essence, an individual colony that can be picked by inoculating loop in order to have and maintain a pure culture.
Download Original Figure
labp-8-1-17-g2
Fig. 2. Grams staining under ×100 oil immersion. Colony morphology and Gram stain property observed under oil immersion microscope ascertaining that isolate is Grams’ positive.
Download Original Figure
Biochemical Characterization of the Isolated Lactic Acid Bacteria
Growth at different temperature

After 24 h of incubation at 37°C all isolates grew with a pattern also observed by Reuben et al. (2019) during the selection of LAB for poultry probiotic a credence to their optimum temperature. In order to differentiate further, LAB growth at 15°C and 45°C were investigated and divided into four groups based on growth pattern. Those that grew only at optimum temperature and could not tolerate 15°C and 45°C makes the highest number of the isolates at 55%, followed by 27.5% that grew only at 45°C. Only one isolate (1.25%) grew at both temperatures while 15% of the isolate tolerated 15°C but not 45°C. According to their thermo-tolerance, the probable organism (Table 2) is in-line with Briugs (1953) observation as the range of temperature LAB can tolerate determines its industrial application. However, there are many overlaps and usage of growth temperature for differential test is not accurate.

Table 2. Probable organism based on growth at different temperature
Group Growth @Temp Probable organism
15°C 45°C
I - - Lactobacillus bulgaricus, Lactobacillus acidophilus
II + + Lactobacillus helveticus, Lactobacillus casei
III + - Lactobacillus plantarum, Lactobacillus pentosus
IV - + Lactobacillus thermophilus, Lactococcus lactis
Download Excel Table
Tolerance of lower pH

From the analysis, 59 (73.8%) isolates tolerated the acidic medium while 21 (26.2%) lost their viability (Table 3). The possibility that majority tolerated pH 3 above 3 h can be predicted and it’s in agreement with the reports of Argyri et al. (2013) and Reuben et al. (2019) of the ability of LABs to tolerate lower pH.

Table 3. Growth of lactic acid bacteria isolates at pH 3 (OD600nm)
S/N Strain pH 3 S/N Strain pH 3
1. YZ01 1.526±0.05g 41. KA24 1.198±0.002h
2. YZ02 0.705±0.01b 42. KA25 0.426±0.001a
3. YZ03 1.493±0.05g 43. KA27 0.969±0.01d,e,f,g,h
4. YZ04 1.574±0.02g 44. KA29 1.448±0.01i
5. YZ07 1.019±0.06d,e 45. KA30 1.166±0.26g,h
6. YZ08 1.272±0.02f 46. YA01 0.517±0.05a,b
7. YZ09 0.940±0.26c,d 47. YA03 0.707±0.01b,c
8. KZ01 0.947±0.01c,d 48. YA06 0.754±0.03c,d
9. KZ02 1.628±0.06g 49. YA07 0.412±0.04a
10. KZ03 1.634±0.01g 50. YA08 0.882±0.02c,d,e,f
11. KZ04 1.553±0.00g 51. YA09 1.808±0.05k
12. KZ05 0.394±0.03a 52. YA10 0.410±0.03a
13. KZ06 1.613±0.00g 53. KB01 1.400±0.10f,g
14. KZ07 1.139±0.01e,f 54. KB02 0.385±0.00a
15. KZ08 0.462±0.01a 55. KB03 1.460±0.08f,g
16. KZ09 0.443±0.02a 56. KB05 2.213±0.02i
17. KZ10 0.441±0.005a 57. KB06 1.757±0.04h
18. KZ11 0.792±0.15b,c 58. KB07 0.514±0.02a,b
19. KA01 0.477±0.01a,b 59. KB12 ND
20. KA02 1.592±0.03i.j 60. KB15 0.393±0.01a
21. KA03 1.028±0.02e,f,g,h 61. KB16 ND
22. KA04 1.626±0.00i.j 62. KB17 0.745±0.01b,c,d
23. KA05 0.985±0.01e,f,g,h 63. KB23 1.678±0.01g,h
24. KA06 0.379±0.02a 64. KB25 1.824±0.03 h
25. KA08 0.376±0.02a 65. KB26 0.679±0.09b,c
26. KA09 0.832±0.01c,d,e 66. KB28 1.266±0.01e,f
27. KA10 1.656±0.04 i.j 67. KB29 0.993±0.03d,e
28. KA11 0.428±0.01a 68. KB30 1.583±0.04g,h
29. KA12 1.061±0.01e,f,g,h 69. KB31 2.878±0.21j,k
30. KA13 0.972±0.004d,e,f,g,h 70. KB32 1.757±0.01h
31. KA14 1.024±0.01e,f,g,h 71. KB33 0.986±0.11d,e
32. KA15 0.404±0.01a 72. KB34 0.613±0.10a,b,c
33. KA16 0.896±0.01c,d,e,f 73. KB35 0.681±0.15b,c
34. KA17 0.443±0.01a 74. KB36 2.926±0.21l
35. KA18 0.370±0.01a 75. KB37 1.645±0.05 g,h
36. KA19 1.085±0.04f,g,h 76. KB38 2.858±0.21j,k
37. KA20 0.983±0.03d,e,f,g,h 77. KB39 0.734±0.07b,c,d
38. KA21 1.056±0.19e,f,g,h 78. KB40 0.837±0.02c,d
39. KA22 0.938±0.002c,d,e,f,g 79. KB41 2.597±0.21j
40. KA23 0.926±0.05c,d,e,f 80. KB42 0.833±0.08c,d

pH=Mean±SD.(n=3) Isolates with same superscript are not significantly different from each other (p<0.05) using one way analysis of variance (ANOVA) and Duncan’s multiple range test.

Download Excel Table
Growth at different NaCl concentration

The growth pattern to different salt concentration alongside other physiological and biochemical properties is in accordance to the description in Bergey’s manual of determinative bacteriology similar to reports by Shehata et al. (2016) in screening for LAB for lowering cholesterol. All isolates have distinctive pattern of salt toleration (Table 4) which is in variance to the report of Hawaz, (2014) where all isolated LABs tolerated 2%, 4% and 6.5% salt concentration.

Table 4. Growth of isolated lactic acid bacteria at different salt concentration
Group NaCl concentration Count (%) (n=80)
2% 4% 6.5%
I + + + 26 (32.5)
II + + - 21 (26.25)
III + - - 22 (27.5)
IV + - + 0 (0)
V - + - 3 (3.75)
VI - + + 2 (2.5)
VII - - + 1 (1.25)
VIII - - - 5 (6.25)

Key: (+)=Growth, (-)=No growth.

Download Excel Table
Carbohydrate fermentation profile of the isolated lactic acid bacteria

All the LAB isolates were able to ferment glucose to produce lactic acid, although, as noted by Briugs (1953) the carbohydrate fermentation profile is not a definitive means for classification as it is strain dependent and gives a varying result depending on other factors of growth. Thus, it is problematic to separate the isolates especially the closely related ones based on their fermentation profile. However, it gave an understanding and a lead on their bacteriological classification (Dowarah et al., 2018). Lactobacillus oris were the most probable organism according to the fermentation profile (Supplementary 4) followed by Lactobacillus fermentum which was later confirmed by molecular method. Lactobacillus rhamnosus, L. curvatus, L. brevis were the list predominant (Fig. 3).

labp-8-1-17-g3
Fig. 3. Frequency of occurrence (%) of all the lactic acid bacteria identified based on carbohydrate fermentation profile. Based on fermentation profile probable organism was suggested using ABIS online bacteria identification software.
Download Original Figure
Antibiotic Resistance Pattern of the Isolated Lactic Acid Bacteria

From this study, 95% of the isolates were resistant to vancomycin, while 46.8% were resistant to gentamycin with erythromycin recording the lowest at 3.2% resistance (Supplementary 6 ). Lactic acid bacteria in many reports have shown to be susceptible to erythromycin while they have natural resistance ability to vancomycin (Fguiri et al., 2016).

Molecular Identification of the Isolated Lactic Acid Bacteria

From the thirty-four isolates subjected to molecular identification using universal primers, three genera [Limosilactobacillus (68%); Lactiplantibacillus (6%) and Weissella (3%)] were identified while Pediococcus (3%); Oenococcus (3%); Lactococcus (3%) and Leuconostoc (3%) had a percentage similarity less than 97% and their identity was not ascertained (Table 5). Considering that Limosilactobacillus was dominant, specific primer for L. fermentum was used to amplify DNA of a further thirty-two isolates with fourteen (14) of the isolates confirmed as L. fermentum. Limosilactobacillus fermentum was the most common LAB associated to both food samples, followed by Lactiplantibacillus plantarum (Table 5). The molecular relationship between the isolates is illustrated by a phylogenetic tree (Fig. 4).

Table 5. List of identified isolates using 16S rRNA gene sequence
S/N Isolate Identified organism Accession number Percentage similarity (%)
1. YZ01 Limosilactobacillus fermentum MT464039.1 100
2. YZ04 Limosilactobacillus fermentum MK235130.1 100
3. YZ07 Lactiplantibacillus plantarum KY435762.1 99.74
4. YZ08 Limosilactobacillus fermentum MK235130.1 99.79
5. KZ01 Limosilactobacillus fermentum MT604785.1 99.87
6. KZ02 Limosilactobacillus fermentum MT613608.1 99.78
7. KZ04 Limosilactobacillus fermentum MF989237.1 99.37
8. KZ06 Limosilactobacillus fermentum KY471691.1 100
9. KZ11 Limosilactobacillus fermentum MN938132.1 99.88
10. KA03 Limosilactobacillus fermentum MW555791.1 100
11. KA10 Limosilactobacillus fermentum MT538902.1 100
12. KA14 Limosilactobacillus fermentum MG461546.1 100
13. KA20 Limosilactobacillus fermentum MT597591.1 100
14. KA27 Limosilactobacillus fermentum MT597562.1 100
15. KA29 Lactiplantibacillus plantarum MK203027.1 99.88
16. YA03 Weissella confusa MH656831.1 99.64
17. KB05 Limosilactobacillus fermentum MN241991.1 100
18. KB06 Limosilactobacillus fermentum MF425058.1 100
19. KB23 Limosilactobacillus fermentum MT538674.1 100
20. KB30 Limosilactobacillus fermentum MT572999.1 100
21. KB31 Limosilactobacillus fermentum MT538900.1 100
22. KB32 Limosilactobacillus fermentum MT464039.1 100
23. KB36 Limosilactobacillus fermentum MT463846.1 100
24. KB37 Limosilactobacillus fermentum MG245799.1 100
25. KB41 Limosilactobacillus fermentum MT613608.1 99.76
26. KA02 Limosilactobacillus fermentum MH732991.1 97.19
27. KZ07 Streptococcus uberis LS483408.1 96
28. KA04 Limosilactobacillus fermentum MF425058.1 95.12
29. KB33 Leuconostoc gelidum CP003839.1 90.62CG
30. YZ09 Lactobacillus helveticus CP015498.1 85.29
31. KB28 Lactococcus lactis subsp. lactis CP015904.1 82.93CG
32. KB17 Oenococcus kitaharae LC483551.1 81.01
33. KB38 Limosilactobacillus fermentum MH517341.1 80.55
34. YA08 Pediococcus pentosaceus FJ538570.1 69.23

CG Complete genome, identity of isolate with similarity < 97% are considered uncertain.

Download Excel Table
labp-8-1-17-g4
Fig. 4. Phylogenetic tree of lactic acid bacteria isolated from the fermented food. Phylogenetic tree of lactic acid bacteria isolated from the fermented food based on the alignment of the partial 16S rRNA sequences of the LAB isolates from this study. The isolates from this study are annotated with blue bullet and their relationship with other isolates from different sources is presented in the phylogenetic tree.
Download Original Figure

DISCUSSION

In traditional fermented foods, LAB considerably are crucial for the overall fermentation process (Aspri et al., 2020), product flavor (Dinesh, 2015; Bayili et al., 2019), taste (Adaramola-Ajibola et al., 2019) and shelf life (Ikpoh et al., 2013; Silva et al. 2018). The local producer have virtually no knowledge of the role of microorganism behind the process; but in order to scale up the production, the common LABs involved in the fermentation need to be identified and characterized for commercial use as starter culture, nutrient improvement, safety purpose and development into a probiotic product. Probiotic market in Africa is still very limited, hence there is need to have more investigation on the diversity of LAB present in the traditionally fermented food; one in which this study have focused on identifying while further study on their probiotic potential is essential.

From the study there was no statistically significant difference between the isolates that grew and did not grow at 15°C (F(2,77) = 0.151, (p = 0.070) or at 45°C (F(2,77) = 0.391, (p = 0.069) while there was a statistically significant difference between their ability to grow at pH 3 and their fermentation pathway (F(2,77) = 4.267, (p = 0.017). This reveals that the fermentation pathway has no correlation with the temperature of growth while it is unlikely due to chance that their ability to grow at pH 3 is dependent on their fermentation pathway. The ability for the isolate to grow in an acidic condition is an important selection criterion for LAB (Sharpe, 1979; Teuber, 2008; Reuben et al., 2019) and in the present study 73.8% of the strains were able to tolerate a lower pH indicating that 26.2% of the isolate are not desirable for acidic industrial application (Table 3). The strains that grow at higher temperature of 45 °C and are able to tolerate pH 3 stood at 33.9%, significantly this isolate can be explored for industrial production that involves high heat (Luo et al., 2011; Amarantini et al., 2019) while 23.9% of the strains that makes up the isolates that grows at 15°C can be useful in improving technological properties and shelf-life of food product that needs cold storage for stability (Mombelli and Gismondo, 2000; Kisan et al., 2019).

Likewise, as part of the physiological property is the growth pattern to different salt concentration alongside other physiological and biochemical properties. High salt can damage the activities of certain enzymes thereby affecting bacterial physiology and metabolism (Olajugbagbe et al., 2020). Each strain has a different composition of membrane phospholipid and the ATP-dependent glycine is strain-specific too, thus the tolerance to osmotic pressure exerted by high salt varies with each isolate a pattern that was noticeable in this study (Table 4). Hence, the pattern observed in this study is in accordance with the description reported by Shehata et al. (2016) in screening for LAB for lowering cholesterol. Nevertheless, the result is different to the report of Hawaz (2014) where all isolated LABs tolerated 2%, 4% and 6.5% salt concentration. Prabhurajeshwar and Chandrakanth (2019) reported in their study that Lactobacillus sp. isolated from yoghurt tolerates NaCl concentration up to 9 % (w/v) but the best growth is observed between 1 % - 5 % (w/v) NaCl concentrations.

The carbohydrate profile of the LAB isolates was studied and all showed the ability to ferment glucose to produce lactic acid. Relying on carbohydrate fermentation profile for identification can be misleading, as it is usually not accurate enough to identify up to species level as several LAB species have similar physiological characteristics (Dowarah et al. 2018). In this study, the identification to genus level by carbohydrate fermentation profile is accurate when compared to the molecular result while only 4 % of the isolate were accurately identified up to species level. The result is similar to Dowarah et al. (2018) where all LAB isolates were able to utilize maltose, fructose, dextrose and mannose and the majority showed a positive reaction for the fermentation of lactose, galactose, trehalose, and mellobiose. Although, the sources of the LAB isolates varied widely in their study, while this study the LAB isolates were from fermented drinks. The similarity in fermentation profile will give misinformation on their relatedness if considered solely. As noted by Reuben et al. (2019) the identification of LAB by carbohydrate profile is very inconsistent and should not be relied on for species-level identification. Thus, it is problematic to separate the isolates especially the closely related ones based on their fermentation profile.

One important benefit for the ability of the isolates to utilize lactose is their possible usage in the treatment of lactose-intolerant individuals. Dimidi et al. (2019) reported that keffir – a fermented milk is the most investigated fermented food for lactose-intolerance treatment as lactose-fermenting LAB have been isolated from it and studied while Valero-cases et al. (2020) have suggested that non-dairy fermented beverages can be the solution for people that are lactose-intolerant and cannot consume the dairy product. In this present study, the focus has been on both dairy and non-dairy fermented products with 95% of the isolate having the ability to utilize lactose (Supplementary 4). Hence, kunun-zaki can be developed as a non-dairy carrier for lactose-fermenting probiotics for the management of lactose-intolerant individuals. Such strain can be used as well for the control or industrial fermentation of kindirmo that will have the property of reducing the lactose concentration by hydrolysing the lactose in the drink thereby allowing people suffering from lactose mal-absorption to tolerate the consumption of kindirmo.

In addition, considering that antibiotic resistance is a major food safety concern in production, it will be undesirable to use LAB that have the propensity to transfer antibiotic resistance gene to other organisms (Vieco-Saiz et al., 2019). Vancomycin is an example of an antimicrobial agent that LAB has intrinsic resistance. Vancomycin sensitivity has also been utilised in the delineation of LAB in bacteria taxonomy (Zheng et al., 2020). Thus, resistance to vancomycin (Zhang et al., 2016) and in some cases gentamicin (Makete, 2016) is one of the crucial indicators in LAB antibiotic resistant pattern for selection for further study as a potential probiotic as they do not carry the resistant gene in the plasmid but in the chromosome, which is not transferrable by horizontal gene transfer. The antibiotic resistant pattern was studied in order to determine whether a LAB isolate is resistant to antibiotics it should be naturally susceptible too and in the case of resistance chances are it has been acquired; such strain will not be suitable for further use according to CLSI guidelines. From this study 10% of the isolate had mild sensitivity between 10mm to 25mm to vancomycin (10 μg). As resistance to vancomycin in LAB is intrinsic, those that showed some forms of susceptibility were not considered as a suitable candidate for further study. The result from this study is in agreement with Makete (2016) where all LAB isolated from milk of South African Saanen goats were all resistant to vancomycin and gentamicin. In addition, Zhang (2016) reported 100% resistance to vancomycin and streptomycin by LAB isolated from traditional Tibetan qula – a raw yak milk. This study is also similar to the report of Shehata et al. (2020) that described eight different LAB isolated from traditionally fermented milk in Egypt that has 100% resistance to vancomycin.

Taking into consideration all the physiological and biochemical factors, 34 strains were selected for 16S rRNA gene sequence analysis that identified 3 genera of the LAB with Limosilactobacillus being the predominant genera (Table 5). The genus Lactobacillus with over 255 species has been reclassified into 25 different genera and the original genus Lactobacillus that was described from Lactobacillus delbrueckii in 1901 retaining only 35 species while the remaining were placed under Paralactobacillus and 23 other genera (Claesson et al., 2008; Salvetti et al., 2018; Zheng et al., 2020). The genera Limosilactobacillus makes up the highest number of LAB isolated in line with reports of Lactobacillus fermentum from Kunun-zaki by Franz et al. (2014) and Lactobacillus plantarum from kindirmo (Igwe et al., 2014) which is similar to the result in this study. The report from this study is also comparable to those of Olasupo et al. (1997), Todorov et al. (2008) and Fapohunda and Adeware, (2012). In addition, the isolates from this study (Fig. 3) has a close relationship with other species from different sources and location. This indicates that though they were isolated from separate sources their genetic relationship does not differ much especially in terms of taxonomy. However, if complete genome was carried out there will be quite a few specific genes that distinguishes them at strain level.

The hallmark of this study was to identify the presence of LAB (LAB) involved in the chance fermentation of the two traditionally fermented food samples. Combining the physiological and biochemical properties for the identification of LAB and confirming the identity of isolates with molecular tool, the presence of LAB were established. Also, the isolates were grouped to 16 clusters based on their morphological identity and the sugar utilization profile across the group varied widely indicating variations at the strain level (Dowarah et al., 2018).

Moreover, the ability of each isolates to tolerate diverse range of temperature, salinity and carbohydrate fermentation pathway points to the huge diversity at the species level of the isolates which present a huge advantage for more study of all individual organism for their specific properties. Consequently, from the antibiotics sensitivity pattern, none of the isolates appears to carry transferrable antibiotic resistant gene as they were resistant and susceptible to antibiotics in same pattern as highlighted in CLSI guidelines and in line with most research submission making them a good candidate for industrial process (Zhang et al., 2016; Fguiri et al., 2016; Bayili et al., 2019). To the best of our knowledge this is the first study that focused majorly on characterizing the LAB present in kunun-zaki and kindirmo for the purpose of identifying the predominant LAB that can be studied further for their probiotic potential. Majority of the study focuses on sensory characteristics (Adaramola-Ajibola et al., 2019; Jaiyeoba et al., 2019), variations in the starter culture (Igwe et al., 2014), microbiological quality and bacteria succession (Abdullahi et al., 2001; Gaffa and Gaffa, 2004; Fapohunda and Adeware, 2012) in kunun-zaki and kindirmo.

CONCLUSION

The combination of physiological and biochemical tests have been used to characterise LAB isolated while 16S rRNA gene have been used for the confirmation of their identity. Each strain has its spectrum of temperature, acidity and salinity it can tolerate while the carbohydrate fermentation pathways are divergent and strain specific. Moreover, LAB isolated from this study are mostly from Limosilactobacillus genera which are in line with couple of studies on other fermented drink from West Africa. It is to be noted that Lactobacillus is one of the major microorganisms used for probiotic development (Heinen et al., 2020; Pasolli et al., 2020) and this study further cement the concept that traditionally fermented foods are a good natural source for beneficial bacteria. Hence, some of the strains can be investigated further in order to determine their suitability as a starter culture for the industrial production of kunun-zaki and kindirmo. Additionally, study on their ability to produce bacteriocin for application in food preservation and probiotic potential for functional food development in medical application is a good future prospect worth exploring in addition to their probiotic potential.

Acknowledgment

We appreciate Erevena Biosciences Laboratory, Ibadan, Nigeria for the facility provided for the isolation and storage of isolates, the Director India Council of Medical Research - National Institute of Malaria Research (ICMR-NIMR) for providing enabling environment for the study and also grateful to Prof. Gordon Awandare, Director West Africa Centre for Cell Biology of Infectious Pathogens for the bench space to conduct molecular analysis.

The study was supported by the fellowship received by BT from West Africa Research Council (WARA/WARC), Boston USA, The World Academy of Sciences (TWAS), Italy [FR number 3240306342] and the Department of Biotechnology (DBT), India [BT/AB/03/04/2002].

Conflict of Interest

The authors declare that there is no conflict of interest in the publication.

Authors Contribution

BT conceived the idea, performed the experiments and analysed the data. BT, AIO, IHI, BM and ARA were involved in the design of different stages of the experiments. BT, SS performed the molecular identification. BT wrote the manuscript, ARA, AIO, IHI, BM, SS, LDK, ENA reviewed and edited the manuscript. ENA, ARA, LDK and SS Contributed reagents/materials/analysing tools. ARA, AIO, IHI, BM and ENA supervision of different aspect of the study. All Authors read and approved the final manuscript and stated that it has not been published elsewhere.

References

1.

Adaramola-Ajibola KM, Osaloni AR, and Arijeniwa OC (2019) Nutritional composition, microbiological quality and sensory properties of Kunu-zaki produced from millet and tigernut blend. Asian Food Science Journal. 13, 1-10,

2.

Abdullahi IO, Dauda I, and Tonak A (2001) Microbiological profile of Nono and Kindirmo as sold in Samaru-Zaria. Nigeria Journal of Biotechnology12, 69-73.

3.

Amarantini C, Satwika D, Budiarso TY, Yunita ER, and Laheba EA (2019) Screening of antimicrobial-producing LAB isolated from traditional fish fermentation against pathogenic bacteria. J. Phys. Conf. Ser.1397(1),

4.

Anukam KC and Reid G (2009) African traditional fermented foods and probiotics. J. Med. Food12, 1177-1184.

5.

Argyri AA, Zoumpopoulou G, Karatzas KA, Tsakalidou E, Bychas GJ, Panagou EZ, and Tassou CC (2013) Selection of potential probiotic lactic acid bacteria from fermented olives by in vitro tests. Food Microbiol.33, 282-291.

6.

Aspri M, Papademas P, and Tsaltas D (2020) Review on non-dairy probiotics and their use in non-dairy based products. Ferment.6, 1-20.

7.

Bamgbose T and Sumit S (2014) Isolation and characterisation of microbes producing bacteriocin from curd, raw milk and soil and its preservative effects. Int. J. Pharm. Sci. Res.5, 1942-1948.

8.

Bassyouni RH, Abdel-all WS, Fadl MG, Abdel-all S, and Kamel Z (2012) Characterization of lactic acid bacteria isolated from dairy products in Egypt as a probiotic. Life Sci.9, 2924-2930.

9.

Bayili GR, Johansen P, Nielsen DS, Sawadogo-Lingani H, Ouedrago GA, Diawara B, and Jespersen L (2019) Identification of the predominant microbiota during production of lait caillé, a spontaneously fermented milk product made in Burkina Faso. World J. Microbiol. Biotehnol.35, 100.

10.

Briugs M (1953) The classification of lactobacilli by means of physiological tests. J. Gen. Microbiol.9, 234-248.

11.

Claesson MJ, van Sinderen D, and O’Toole PW (2008) Lactobacillus phylogenomics—towards a reclassification of the genus. J. Syst. Evol. Microbiol.58, 2945-2954.

12.

CLSI (2010) Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria; Approved Guidelines – Second Edition. CLSI document M45-A2. Wayne, PA. Clinical and Laboratory Standards Institute.

13.

De Man JC, Rogosa M, and Sharpe ME (1960) A medium for the cultivation of lactobacilli. J. Appl. Microbiol.23, 130-135.

14.

Dimidi E, Cox S, Rossi M, and Whelan K (2019) Fermented foods: Definitions and characteristics, gastrointestinal health and disease. Nutrients,11, 26.

15.

Dinesh Raj Modi, MS (2015) Role of lactic acid bacteria as probiotics in health and disease. La Prensa Medica,101, 1-9.

16.

Dowarah R, Verma AK, Agarwal N, Singh P, and Singh BR (2018) Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets. PLoS ONE13(3).

17.

Fguiri I, Ziadi M, Atigui M, Ayeb N, Arroum S, Assadi M, and Khorchani T (2016) Isolation and characterisation of lactic acid bacteria strains from raw camel milk for potential use in the production of fermented Tunisian dairy products. Int. J. Dairy Technol.69, 103-113.

18.

Franz CMAP, Huch M, Mathara JM, Abriouel H, Benomar N, Reid G, Galvez A, and Holzapfel WH (2014) African fermented foods and probiotics. Int. J. Food Microbiol.190, 84-96.

19.

Gaffa T, Jideani IA, and Nkama I (2002) Traditional production, consumption and storage of Kunun a non alcoholic cereal beverage. Plant Foods Hum. Nutr.57, 73.

20.

Gaffa T and Gaffa AT (2004) Microbial succession during ‘Kununn zaki ‘ production with sorghum (Sorghum bicolor) grains. World J. Microbiol. Biotechnol.20, 449-453.

21.

Harrigan WF (1998). Laboratory Methods in Food Microbiology. 3rd ed. Academic Press, New York, USA, p.519.

22.

Hawaz E (2014) Isolation and identification of probiotic lactic acid bacteria from curd and in vitro evaluation of its growth inhibition activities against pathogenic bacteria. Afri. J. Microbiol. Res.8, 1419-1425.

23.

Heinen E, Ahnen R, and Slavin J (2020) Fermented foods and the gut microbiome. Nutrition Science. 55, 163-167.

24.

Holzapfel WH (2002) Appropriate starter culture technologies for small-scale fermentation in developing countries. Int. J. Food Microbiol.75, 197-212.

25.

Ida Muryany MY, Ina Salwany MY, Ghazali AR, Hing HL, and Nor Fadilah R (2017) Identification and characterization of the lactic acid bacteria isolated from Malaysian fermented fish (Pekasam). Int. Res. Food J.24, 868-875.

26.

Igwe EC, Esiobu EN, and Ojimelukwe PC (2014) Variations in the traditional starter culture for production of a Nigerian fermented milk product-(Kindirmo). Focus Modern Food Ind.3, 35.

27.

Ikpoh IS, Lennox JA, Ekpo IA, Agbo BE, Henshaw EE, and Udoekong NS (2013) Microbial quality assessment of kunun beverage locally prepared and hawked in Calabar, Cross River State, Nigeria. Glob. J. Biodivers Sci. Manag.3, 58-61.

28.

Jaiyeoba CN, Oni KO, and Akomolafe DA (2019) Physical, antioxidant and sensory characteristics of kununn-zaki enriched with pumpkin seeds. Applied Tropical Agriculture24, 87-91.

29.

Kavitha JR and Devasena T (2013) Isolation, characterization, determination of probiotic properties of lactic acid bacteria from human milk. J. Pharm. Biol. Sci. (IOSR-JPBS)7(3), 1-7 www.iosrjournals.org

30.

Kisan BS, Kumar R, Ashok SP, and Sangita G (2019) Probiotic foods for human health: A review. J. Pharmacogn. Phytochem.8, 967-971.

31.

Luo F, Feng S, Sun Q, Xiang W, Zhao J, Zhang J, and Yang Z (2011). Screening for bacteriocin-producing lactic acid bacteria from kurut, a traditional naturally-fermented yak milk from Qinghai-Tibet plateau. Food Control.22, 50-53.

32.

Makete G (2016) Isolation, Identification and screening of potential probiotic bacteria in milk from South African Saanen goats. Probiotics Antimicrob.

33.

Mombelli B and Gismondo MR (2000) The use of probiotics in medical practice. Int. J. Antimicrob.16, 531-536.

34.

Oguntoyinbo FA and Arjan Narbad (2012) Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal. Food Microbiol.31, 254-262.

35.

Olajugbagbe, TE, Elugbadebo OE and Omafuvbe BO (2020) Probiotic potentials of Pediococuss acidilactici isolated from wara: A Nigerian unripened soft cheese. Heliyon,6(9). e04889.

36.

Olasupo NA, Olukoya DK, Odunfa SA (1997) Identification of Lactobacillus species associated with selected African fermented foods. Z. Naturforsch. C – J. Biosci.52, 105–108.

37.

Oyewole OB (1997) Lactic fermented foods in Africa and their benefits. Food Control8, 289-297.

38.

Pasolli E, Filippis F, De Mauriello IE, Cumbo F, Leech J, Cotter PD, Segata N, Ercolini D, and Walsh AM (2020) Large-scale genome-wide analysis links lactic acid bacteria from food with the gut microbiome. Nat. Commun.11, 1-12.

39.

Prabhurajeshwar C and Chandrakanth K (2019) Evaluation of antimicrobial properties and their substances against pathogenic bacteria in-vitro by probiotic Lactobacilli strains isolated from commercial yoghurt. Clin. Nutr. Exp.23, 97-115.

40.

Reuben RC, Roy PC, Sarkar SL, Alam RU, and Jahid IK (2019) Isolation, characterization, and assessment of lactic acid bacteria toward their selection as poultry probiotics. BMC Microbiol.19(1), 253.

41.

Salvetti E, Harris HMB, Felis GE, and O’Toole PW (2018) Comparative genomics of the genus Lactobacillus reveals robust phylogroups that provide the basis for reclassification. Appl. Environ.84, 1-15.

42.

Sharpe ME (1979) Identification of lactic acid bacteria. In: Skinner FA, Lovelock DW (eds), Identification Methods for Microbiologists, London: Academic Press, pp. 233-259.

43.

Shehata MG, El Sohaimy SA, El-Sahn MA, and Youssef MM (2016) Screening of isolated potential probiotic lactic acid bacteria for cholesterol lowering property and bile salt hydrolase activity. Ann. Agric. Sci.61(1).

44.

Shehata AF, Zayed G, Saad OAO, and Salwa AHG (2020) Antimicrobial activity and probiotic properties of lactic acid bacteria isolated from traditional fermented dairy products. J. Mod. Sci.2, 40-48. www.jmr.journals.ekb.eg

45.

Silva CCG, Silva SPM, and Ribeiro SC (2018) Application of bacteriocins and protective cultures in dairy food preservation. Front. Microbiol.9(4).

46.

Sudi IY, De N, and Dunkrah UA (2011) Nigerian indigenous yoghurt (kindirmo) production using Lactobacillus bulgaricus and Streptococcus thermophilus mutants as starter culture. Afri. J. Biotechnol.10, 1651–1654.

47.

Tamang J and Samuel D (2010) Dietary cultures and antiquity of fermented foods and beverages. In: Tamang JP, Kailasapathy K (eds), Fermented Foods and Beverages of the World. CRC press, London, pp. 1-40.

48.

Teuber M (2008) Lactic acid bacteria. Biotechnol.1, 325-366.

49.

Todorov SD, Botes M, Guigas C, Schillinger U, Wiid I, Wachsman MB, Holzapfel WH, and Dicks LMT (2008) Boza, a natural source of probiotic lactic acid bacteria. J. Appl. Microbiol.104, 465-477.

50.

Valero-cases E, Cerdá-bernad, D, Pastor J, and Frutos M (2020) Non-dairy fermented beverages as potential carriers to ensure probiotics, prebiotics, and bioactive compounds arrival to the gut and their health benefits. Nutrients,12, 1666

51.

Vieco-Saiz N, Belguesmia Y, Raspoet R, Auclair E, Gancel F, Kempf I, and Drider D (2019) Benefits and inputs from lactic acid bacteria and their bacteriocins as alternatives to antibiotic growth promoters during food-animal production. Frontiers in Microbiology,10, 1-17.

52.

Zhang B, Wang Y, Tan Z, Li Z, Jiao Z, and Huang Q (2016) Screening of probiotic activities of lactobacilli strains isolated from traditional Tibetan Qula, a raw yak milk cheese. Asian Australas. J. Anim. Sci.29, 1490-1499.

53.

Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O’Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Gänzle MG, and Lebeer S (2020) A taxonomic note on the genus lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of lactobacillaceae and leuconostocaceae. Int. J. Syst. Evol.70(4), 2782-2858.